Review



imagelab software version 4 1  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad imagelab software version 4 1
    Imagelab Software Version 4 1, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36371 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imagelab+software+version+4+1/Image+Lab+Software/pm41983566-121-10-14
    Average 99 stars, based on 36371 article reviews
    imagelab software version 4 1 - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Software:

    Article Title: Metabolic traits shape responses to LSD1-directed therapy in glioblastoma tumor-initiating cells
    Article Snippet: Primary antibodies used the following: anti-ATF4 (Cell Signaling Technology, #11815S; 1:500), anti–phospho-eIF2α (Cell Signaling Technology, #3398S; 1:1000), anti-eIF2α (Cell Signaling Technology, #5324S; 1:1000), anti-LSD1 (Cell Signaling Technology, #2139A; 1:1000), anti-LSD1 (Cell Signaling Technology, #2139A; 1:1000), anti-vinculin (Sigma-Aldrich, #V9131; 1:5000), anti-HKI (Cell Signaling Technology, #2024; 1:1000), anti-HKII (Cell Signaling Technology, #2867; 1:1000), anti-PKM2 (Cell Signaling Technology, #4053; 1:1000), anti-GAPDH (Cell Signaling Technology, #5174; 1:1000), anti-PFKP (Cell Signaling Technology, #8164; 1:1000), anti-LDHA (Cell Signaling Technology, #3582; 1:1000), anti–α-tubulin (Santa Cruz Biotechnology, #32293; 1:5000), and anti-PERK (Cell Signaling Technology, #3192S; 1:1000). .. Densitometric quantification of band intensity was performed using the Band Analysis tools of ImageLab software version 4.1 (Bio-Rad). .. GBM TIC pellets were digested using the iST sample preparation kit (PreOmics), following the manufacturer’s guidelines.

    Article Title: Application of bioinformatics analysis and molecular docking to study the mechanism of Qingying decoction in treating psoriasis.
    Article Snippet: The protein bands were detected with a BeyoECL Plus kit (Beyotime, Shanghai, China). .. ImageLab software version 4.1 (BioRad Laboratories, Hercules, CA, USA) was used for gray density value analysis. ..

    Article Title: Downregulation of kinetochore-associated 1 gene increases lagging chromosomes and contributes to chromosomal instability in gastric cancer cells.
    Article Snippet: Protein bands were detected using a ChemiDoc MP Imaging System (Bio‐Rad Laboratories, Inc.). .. Quantitative analysis was performed using ImageLab software version 4.1 (Bio‐Rad Laboratories, Inc.). siRNA‐mediated knockdown of KNTC1. .. The sequence (GGAAUGAUAUUGAGCUGCUAACAAA) of human KNTC1 siRNA was designed from Thermo Fisher Scientific, Inc. (cat. no. HSS114610).

    Article Title: FGFR2 is a Candidate Immune‐Associated Marker of Diabetic Foot Ulcer That Promotes Keratinocyte Function by Activating the PI3K/Akt and MAPK Pathways
    Article Snippet: After washing three times with tris buffered saline tween (TBST), the membranes were incubated with the secondary antibody (1:5000, ab205718, Abcam) at room temperature for 2 h. The protein bands were detected using the BeyoECL Plus kit (Beyotime). .. Image acquisition and density value analysis were performed using ImageLab software version 4.1 (Bio‐Rad). .. The HaCaT cells in each group were seeded in 96‐well plates (1 × 10 4 cells, in 100 μL cell suspension per well), and cultured for 24 h. Then 10 μL of Cell Counting Kit‐8 (CCK‐8; Beyotime) solution was added into each well, and incubated in the incubator for 2 h. The absorbance (OD) value at a wavelength of 450 nm was detected using an microplate reader (Dynatech Labs, Chantilly, VA, USA).

    Article Title: FGFR2 is a Candidate Immune-Associated Marker of Diabetic Foot Ulcer That Promotes Keratinocyte Function by Activating the PI3K/Akt and MAPK Pathways.
    Article Snippet: The protein bands were detected using the BeyoECL Plus kit (Beyotime). .. Image acquisition and density value analysis were per- formed using ImageLab software version 4.1 (Bio-Rad). .. The HaCaT cells in each group were seeded in 96-well plates (1× 104 cells, in 100 μL cell suspension per well), and cultured for 24 h. Then 10 μL of Cell Counting Kit-8 (CCK-8; Beyotime) 108 DE-IRGs 48 upregulation and 60 down-regulation GSE80178 6 DFU vs. 3 DFS “Limma” R 1926 DEGs adj.p<0.05 and |log2FC|<1 Immune infiltration analysis “CIBERSORT” “EPIC” GO and KEGG analysis PPI network “clusterProfiler” R STRING FGF2/FGF7/FGFR2/IGF1/KITLG CytoHubba plug-in Expression ROC curve GSE199939 GSE134431 GSE80178 + GSE134431 Spearman correlation analysis Validation sets Molecular docking AutoDock Vina Drugs L1000FWD Immune-related genes Immport

    Article Title: Application of bioinformatics analysis and molecular docking to study the mechanism of Qingying decoction in treating psoriasis
    Article Snippet: The protein bands were detected with a BeyoECL Plus kit (Beyotime, Shanghai, China). .. ImageLab software version 4.1 (Bio-Rad Laboratories, Hercules, CA, USA) was used for gray density value analysis. ..

    Article Title: Metabolic traits shape responses to LSD1-directed therapy in glioblastoma tumor-initiating cells.
    Article Snippet: Primary antibodies used the following: anti- ATF4 (Cell Signaling Technology, #11815S; 1:500), anti–phospho- eIF2α (Cell Signaling Technology, #3398S; 1:1000), anti- eIF2α (Cell Signaling Technology, #5324S; 1:1000), anti- LSD1 (Cell Signaling Technology, #2139A; 1:1000), anti- LSD1 (Cell Signaling Technology, #2139A; 1:1000), antivinculin (Sigma- Aldrich, #V9131; 1:5000), anti- HKI (Cell Signaling Technology, #2024; 1:1000), anti- HKII (Cell Signaling Technology, #2867; 1:1000), anti- PKM2 (Cell Signaling Technology, #4053; 1:1000), anti- GAPDH (Cell Signaling Technology, #5174; 1:1000), anti- PFKP (Cell Signaling Technology, #8164; 1:1000), anti- LDHA (Cell Signaling Technology, #3582; 1:1000), anti–α- tubulin (Santa Cruz Biotechnology, #32293; 1:5000), and anti- PERK (Cell Signaling Technology, #3192S; 1:1000). .. Densitometric quantification of band intensity was performed using the Band Analysis tools of ImageLab software version 4.1 (Bio- Rad). .. GBM TIC pellets were digested using the iST sample preparation kit (PreOmics), following the manufacturer’s guidelines.

    Article Title: Combining network pharmacology and molecular docking to explore the pharmacological mechanism of Codonopsis Radix.-Hedysarum Multijugum Maxim.-Atractylodes Macrocephala Koidz. in treating lung cancer.
    Article Snippet: It was then incubated with HRP-coupled goat anti-rabbit secondary antibody (ab6721, 1:5000, Abcam) for 2 h. The protein signal of the membrane was detected using the ECL Plus assay kit (Pierce, Rockford, IL, USA). .. Protein expression was quantified using ImageLab software version 4.1 (Bio-Rad Laboratories, Hercules, CA, USA). ..

    Knockdown:

    Article Title: Downregulation of kinetochore-associated 1 gene increases lagging chromosomes and contributes to chromosomal instability in gastric cancer cells.
    Article Snippet: Protein bands were detected using a ChemiDoc MP Imaging System (Bio‐Rad Laboratories, Inc.). .. Quantitative analysis was performed using ImageLab software version 4.1 (Bio‐Rad Laboratories, Inc.). siRNA‐mediated knockdown of KNTC1. .. The sequence (GGAAUGAUAUUGAGCUGCUAACAAA) of human KNTC1 siRNA was designed from Thermo Fisher Scientific, Inc. (cat. no. HSS114610).

    Expressing:

    Article Title: Combining network pharmacology and molecular docking to explore the pharmacological mechanism of Codonopsis Radix.-Hedysarum Multijugum Maxim.-Atractylodes Macrocephala Koidz. in treating lung cancer.
    Article Snippet: It was then incubated with HRP-coupled goat anti-rabbit secondary antibody (ab6721, 1:5000, Abcam) for 2 h. The protein signal of the membrane was detected using the ECL Plus assay kit (Pierce, Rockford, IL, USA). .. Protein expression was quantified using ImageLab software version 4.1 (Bio-Rad Laboratories, Hercules, CA, USA). ..



    Similar Products

    99
    Bio-Rad imagelab software version 4 1
    Imagelab Software Version 4 1, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imagelab+software+version+4+1/Image+Lab+Software/pm41983566-121-10-14
    Average 99 stars, based on 1 article reviews
    imagelab software version 4 1 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad imagelab version 4 0 1 software
    Imagelab Version 4 0 1 Software, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imagelab+software+version+4+1/Image+Lab+Software/bio_rxiv__64898__2026__03__23__713812-244-35-39
    Average 99 stars, based on 1 article reviews
    imagelab version 4 0 1 software - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad image lab touch software v3 0 1
    Image Lab Touch Software V3 0 1, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imagelab+software+version+4+1/Image+Lab+Touch+Software+for+ChemiDoc+Imagers+Version+2%2E4/pmc12373498-235-13-18
    Average 99 stars, based on 1 article reviews
    image lab touch software v3 0 1 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad image lab touch software version 5 2 1
    Image Lab Touch Software Version 5 2 1, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imagelab+software+version+4+1/Image+Lab+Touch+Software+for+ChemiDoc+Imagers+Version+2%2E4/pm40610637-170-20-29
    Average 99 stars, based on 1 article reviews
    image lab touch software version 5 2 1 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results